View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3424_low_17 (Length: 272)
Name: NF3424_low_17
Description: NF3424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3424_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 13 - 259
Target Start/End: Original strand, 38770401 - 38770648
Alignment:
| Q |
13 |
aatatggttagttaccgtataaaatcatgaagtataattaaatcacaaatccaccgtnnnnnnnn-ctgccaacacaaatttcacctttcataatcaaat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
38770401 |
aatatggttagttaccgtataaaatcatgaagtataattaaatcacaaatccaccgtaaaaaaaaactgctaacacaaatttcacctttcataatcaaat |
38770500 |
T |
 |
| Q |
112 |
agatttttcagcttgatacatgtgtaatgaaagaaacattcttaaacttgtagtttgggatttctctagaatattctcacatgcaaaccacatcaaaatt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38770501 |
agatttttcagcttgatacatgtgtaatgaaagaaacattcttaaacttttagtttgggatttctgtagaatattctcacatgcaaaccacatcaaaatt |
38770600 |
T |
 |
| Q |
212 |
acaatttacattggtgattttttacctatcaatatgataagcaataac |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38770601 |
acaatttacattggtgattttttacctatcaatatgataagcaataac |
38770648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University