View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3424_low_19 (Length: 263)
Name: NF3424_low_19
Description: NF3424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3424_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 57 - 254
Target Start/End: Original strand, 44447405 - 44447607
Alignment:
| Q |
57 |
gcctcttaacaaatatggacggtgagatca-----taagaccggacaatttacatttaattattgtgaattaaatccaaaataaaaaataagaatgtaaa |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44447405 |
gcctcttaacaaatatggacggtgagatcatatcataagaccggacaatttacatttaattattgtgaattaaatccaaaataaaaaataaaaatgtaaa |
44447504 |
T |
 |
| Q |
152 |
atttcgatcttgattggaccgttgagatttgcttggatgttggtgggacaaataatgttgtatgttacactataaatagacatagagttttcagtattca |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44447505 |
atttcgatcttgattggaccgttgagatttgcttggatgttggtgggacaaataatgttgtatgttacactataaatagacatagagtgttcagtattca |
44447604 |
T |
 |
| Q |
252 |
tct |
254 |
Q |
| |
|
||| |
|
|
| T |
44447605 |
tct |
44447607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 46
Target Start/End: Original strand, 44447364 - 44447392
Alignment:
| Q |
18 |
gctctaagcctctaacaaatatagtaaac |
46 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44447364 |
gctctaagcctctaacaaatatagtaaac |
44447392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University