View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3424_low_22 (Length: 205)
Name: NF3424_low_22
Description: NF3424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3424_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 18 - 190
Target Start/End: Original strand, 29066846 - 29067018
Alignment:
| Q |
18 |
catgtgcaatgtgttaaatgagcttggttttcatcccaaataccagctcaagggatgaggctccccaaccattcaagaagaagaannnnnnnggggtagc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
29066846 |
catgtgcaatgtgttaaatgagcttggttttcatcccaaataacagctcaagggatgagggtccccaaccattcaagaagaagaatttttttggggtagc |
29066945 |
T |
|
| Q |
118 |
cttggctacctcgtgccattgaagggcttatgcaatcttagaacacaaagattcaagtagcaagacacctttg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
29066946 |
cttggctacctcgtgccattgaagggcttatgcaatcttagaacacaaaggttcaagtcgcaagacacctttg |
29067018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University