View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3424_low_3 (Length: 467)

Name: NF3424_low_3
Description: NF3424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3424_low_3
NF3424_low_3
[»] chr1 (1 HSPs)
chr1 (22-101)||(14144021-14144100)


Alignment Details
Target: chr1 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 22 - 101
Target Start/End: Complemental strand, 14144100 - 14144021
Alignment:
22 ttttggtggctttaattaccatccgaccattactgttgtggtagctgtgaaggggcatagaacccatttctttcctatgt 101  Q
    ||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14144100 ttttggtggctttaaataccatccaaccattactgttgtggtagctgtgaaggggcatagaacccatttctttcctatgt 14144021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University