View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3424_low_6 (Length: 374)
Name: NF3424_low_6
Description: NF3424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3424_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 84 - 342
Target Start/End: Complemental strand, 36282044 - 36281788
Alignment:
| Q |
84 |
tgggagaggattaaatggaacaatgtgtttctttgttaaataacannnnnnnnngcaggacaatgtgacaactaaacgagtttggttataaaactccatt |
183 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||| || ||||||||| |||||| ||||||||||||||||||||||| |||| |
|
|
| T |
36282044 |
tgggagaggattaaatgaaacaatgtggttctttgttaaatatcattttttt--gcaggacaacgtgacagataaacgagtttggttataaaacttcatt |
36281947 |
T |
|
| Q |
184 |
gatggttatttggtaaatggtgcttatcagaatcttactagagttgaacattctaactttgatattctgtcacacataatttggtataaagttatgcctc |
283 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36281946 |
gatggttatttggtaaagggtgcttatcagattcttactagagttgaatattccaactttgatattctgtcacacataatttggtataaagttatgcctt |
36281847 |
T |
|
| Q |
284 |
taaaagtgtcgttatttgcttggagattttcaattaaagaatcccatcaaaggataata |
342 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
36281846 |
taaaagtatcgttatttgcttggagattttcaattatagaatcccatcaaagaataata |
36281788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 6 - 57
Target Start/End: Complemental strand, 36282122 - 36282071
Alignment:
| Q |
6 |
tgagatgaagaggctaggttgggggtggagaggcatgatggcggtggagagg |
57 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36282122 |
tgagatgaagaggctatgttgggggtggagaggcatgatggcggtggagagg |
36282071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 90 - 128
Target Start/End: Complemental strand, 32661787 - 32661749
Alignment:
| Q |
90 |
aggattaaatggaacaatgtgtttctttgttaaataaca |
128 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
32661787 |
aggattaattggaacaatgtgtttctttgttagataaca |
32661749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University