View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3425_high_51 (Length: 255)
Name: NF3425_high_51
Description: NF3425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3425_high_51 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 17 - 255
Target Start/End: Complemental strand, 3286192 - 3285951
Alignment:
| Q |
17 |
atgaatttcatgtagatatttatctgactgattatatataaatcatattttgttttgtctttggtttaattcaattattaatgnnnnnnn---caatgtg |
113 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
3286192 |
atgaatttcatgtagatacttatctgacttattatatataaatcatattttgttttgtctttggtttaattcaattgttaatgttttttttttcaatgtg |
3286093 |
T |
 |
| Q |
114 |
caatacaaaacgagtttttgatttagaaagtgtgagacatcaactttttatcaaacgaatattgactaaataatgtgcagattctaatgcctagtcatag |
213 |
Q |
| |
|
|||| ||||||||| |||| ||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3286092 |
caattcaaaacgagctttttatttaaaaagtgtgagacatcaactttttatcaaacggatattgactaaataatgtgtagattctaatgcctagtcatag |
3285993 |
T |
 |
| Q |
214 |
atctattttcgcatgcacatacaatgtccaatcatattccat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3285992 |
atctattttcgcatgcacatacaatgtccaatcatattccat |
3285951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 134 - 165
Target Start/End: Original strand, 19462245 - 19462276
Alignment:
| Q |
134 |
atttagaaagtgtgagacatcaactttttatc |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19462245 |
atttagaaagtgtgagacatcaactttttatc |
19462276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 129 - 162
Target Start/End: Complemental strand, 23083884 - 23083851
Alignment:
| Q |
129 |
ttttgatttagaaagtgtgagacatcaacttttt |
162 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
23083884 |
ttttgatttagaaagtgtgagacatcgacttttt |
23083851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 161
Target Start/End: Original strand, 22784153 - 22784185
Alignment:
| Q |
129 |
ttttgatttagaaagtgtgagacatcaactttt |
161 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
22784153 |
ttttgatttagaaagtgttagacatcaactttt |
22784185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 165
Target Start/End: Original strand, 32460199 - 32460235
Alignment:
| Q |
129 |
ttttgatttagaaagtgtgagacatcaactttttatc |
165 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32460199 |
ttttgatttagaaagtgcaagacatcaactttttatc |
32460235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University