View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3425_high_60 (Length: 249)
Name: NF3425_high_60
Description: NF3425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3425_high_60 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 48 - 249
Target Start/End: Original strand, 46321152 - 46321352
Alignment:
| Q |
48 |
attatgtttatgacatgcgtcaaccatggcacccacttgtcactccatcacttgaatagctacattttggtgctattatatggcgtgaccattgcatatt |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46321152 |
attatgtttatgacatgcgtcaaccatggcacc-acttgtcactccatcacttgaatagctacattttggtgctattatatggcgtgaccattgcatatt |
46321250 |
T |
|
| Q |
148 |
aggactcagattttttattcaagataaatgttgctaaattcagttaccggtaatttttagggttttaattgaccacttactacctaattttttaactcac |
247 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46321251 |
aggactcagattttttattcaagaaaaatgttgctaaattcagttaccggtaatttttagggttttaattgaccacttactacctaattttttaactcac |
46321350 |
T |
|
| Q |
248 |
aa |
249 |
Q |
| |
|
|| |
|
|
| T |
46321351 |
aa |
46321352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University