View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3425_high_70 (Length: 245)
Name: NF3425_high_70
Description: NF3425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3425_high_70 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 13 - 229
Target Start/End: Complemental strand, 39586702 - 39586486
Alignment:
| Q |
13 |
gaagaagaagctaagggatttagggagatgattaaggagatggtatcgttgggtggttcgagtaatcctggtgaatttgttgggattttgaggtggttcg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39586702 |
gaagaagaagctaagggatttagggagatgattaaggagatggtatcgttgggtggttcgagtaatcctggtgaatttgttgggattttgaggtggtttg |
39586603 |
T |
|
| Q |
113 |
attttggtggttatgaaaagaagttgaaaaggattgcaagaagatttgatgggtttttgcagggtttgattgatgagcataggaggaagaaggagaaggg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39586602 |
attttggtggttatgaaaagaagttgaaaaggattgcaagaagatttgatgggtttttgcaaggtttgattgatgagcataggaggaagaaggagaaggg |
39586503 |
T |
|
| Q |
213 |
gaataacatgattgatc |
229 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
39586502 |
gaataacatgattgatc |
39586486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University