View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3425_high_72 (Length: 239)
Name: NF3425_high_72
Description: NF3425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3425_high_72 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 21284406 - 21284641
Alignment:
| Q |
1 |
ttctttttaaagaaacattacttttaaactcagctgtaaccaaatcaactgtacatcaaacacttagtagtacagtgtcacttgtgatttggttttggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21284406 |
ttctttttaaagaaacattacttttaaactcagctgtaaccaaatcaactgtacatcaaacacttagtagtacagtgtcacttgtgatttggttttggta |
21284505 |
T |
|
| Q |
101 |
tgagtaggtgacaaagtactattccttgtgagtgcacattgttgtcactgtgtggttgagttcaaattcttgttttttacttttgagagctaatgatgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21284506 |
tgagtaggtgacaaagtactattccttgtgagtgcacattgttgtcactgtgtggttgagttcaaattcttgttttttacttttgagagctaatgatgtt |
21284605 |
T |
|
| Q |
201 |
gccatgtgattgtggccatgatgatgatgtccatct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21284606 |
gccatgtgattgtggccatgatgatgatgtgcatct |
21284641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 170 - 216
Target Start/End: Original strand, 38064249 - 38064295
Alignment:
| Q |
170 |
ttgttttttacttttgagagctaatgatgttgccatgtgattgtggc |
216 |
Q |
| |
|
||||||||| ||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
38064249 |
ttgttttttgcttttgagagctaataatgttgacatgtgattgtggc |
38064295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University