View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3425_high_74 (Length: 238)
Name: NF3425_high_74
Description: NF3425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3425_high_74 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 6e-95; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 4 - 202
Target Start/End: Complemental strand, 31175126 - 31174927
Alignment:
| Q |
4 |
atatggttgggctgccttttgtggacctgttggtcctgttggcaaatctgcttgtggccagtgcttaaatgtatgtatatatgtataatgttagcacttt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31175126 |
atatggttgggctgccttttgtggacctgttggtcctgttggcaaatctgcttgtggcaagtgcttaaatgtatgtatatatgtataatgttagcacttt |
31175027 |
T |
|
| Q |
104 |
acttcttattttattttagtcaaatcgtttggagagaatctcacacataac-cgggttcaaatatccacgccctaaaatgtctttgaaggttacatccac |
202 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31175026 |
acttcttattttatttttgtcaaatcgtttgtagagaatctcacacataacgcgggttcaaatatccacgccctaaaatgtctttgtaggttacatccac |
31174927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 4 - 115
Target Start/End: Complemental strand, 31192624 - 31192512
Alignment:
| Q |
4 |
atatggttgggctgccttttgtggacctgttggtcctgttggcaaatctgcttgtggccagtgcttaaatgtat-gtatatatgtataatgttagcactt |
102 |
Q |
| |
|
|||||||| | |||| |||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||| ||| ||||||||||||| ||| || |
|
|
| T |
31192624 |
atatggtttgactgctttttgtggacctgttggtcctgttggcaaagctgcttgtggcaagtgcttagatgtatcatatgtatgtataatgtttgcagtt |
31192525 |
T |
|
| Q |
103 |
tacttcttatttt |
115 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
31192524 |
tagttcttatttt |
31192512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 165 - 215
Target Start/End: Complemental strand, 31196377 - 31196327
Alignment:
| Q |
165 |
tatccacgccctaaaatgtctttgaaggttacatccactacctaaactgta |
215 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
31196377 |
tatccacgccctaaaatgtctttgcaggttacatccattacctaaactgta |
31196327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 54 - 117
Target Start/End: Complemental strand, 31196444 - 31196375
Alignment:
| Q |
54 |
cttgtggccagtgcttaaatgtatgtatatatgtata------atgttagcactttacttcttattttat |
117 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31196444 |
cttgtggcaattgcttaaatgtatgtatatatgtatatgtataatgttagcactttacttcttattttat |
31196375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 40
Target Start/End: Complemental strand, 35929145 - 35929109
Alignment:
| Q |
4 |
atatggttgggctgccttttgtggacctgttggtcct |
40 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
35929145 |
atatggttggactgccttctgtggacctgttggtcct |
35929109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University