View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3425_high_76 (Length: 237)
Name: NF3425_high_76
Description: NF3425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3425_high_76 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 101 - 201
Target Start/End: Complemental strand, 48580821 - 48580721
Alignment:
| Q |
101 |
gttggttgatgaatgatattgatatgaggtgaggatgctgttttttcaaatttttattatgaatcttctaaacccgcgtgaacccacccgtaaacccgca |
200 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| |||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
48580821 |
gttggttgatgaatgatatagatctgaggtgaggctgctgttttttcaaatttctattatgaatcttctcaacccgcgtgaacccacccgtaaatccgca |
48580722 |
T |
 |
| Q |
201 |
a |
201 |
Q |
| |
|
| |
|
|
| T |
48580721 |
a |
48580721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 101 - 204
Target Start/End: Complemental strand, 2064175 - 2064072
Alignment:
| Q |
101 |
gttggttgatgaatgatattgatatgaggtgaggatgctgttttttcaaatttttattatgaatcttctaaacccgcgtgaacccacccgtaaacccgca |
200 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| | |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
2064175 |
gttggttgatgaatgatatagatctgaggtgaggctactgttttttcaaatttctattatgaatcttctcaacccgcgtgaacccacccgtaaaaccgca |
2064076 |
T |
 |
| Q |
201 |
accc |
204 |
Q |
| |
|
|||| |
|
|
| T |
2064075 |
accc |
2064072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 101 - 204
Target Start/End: Original strand, 19862307 - 19862410
Alignment:
| Q |
101 |
gttggttgatgaatgatattgatatgaggtgaggatgctgttttttcaaatttttattatgaatcttctaaacccgcgtgaacccacccgtaaacccgca |
200 |
Q |
| |
|
||||||||||||||||| | ||| |||||||||| | |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19862307 |
gttggttgatgaatgatgtagatctgaggtgaggctactgttttttcaaatttctattatgaatcttctcaacccgcgtgaacccacccgtaaacccgca |
19862406 |
T |
 |
| Q |
201 |
accc |
204 |
Q |
| |
|
|||| |
|
|
| T |
19862407 |
accc |
19862410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 101 - 204
Target Start/End: Original strand, 19871777 - 19871880
Alignment:
| Q |
101 |
gttggttgatgaatgatattgatatgaggtgaggatgctgttttttcaaatttttattatgaatcttctaaacccgcgtgaacccacccgtaaacccgca |
200 |
Q |
| |
|
||||||||||||||||| | ||| |||||||||| | |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19871777 |
gttggttgatgaatgatgtagatctgaggtgaggctactgttttttcaaatttctattatgaatcttctcaacccgcgtgaacccacccgtaaacccgca |
19871876 |
T |
 |
| Q |
201 |
accc |
204 |
Q |
| |
|
|||| |
|
|
| T |
19871877 |
accc |
19871880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 101 - 204
Target Start/End: Original strand, 19876678 - 19876781
Alignment:
| Q |
101 |
gttggttgatgaatgatattgatatgaggtgaggatgctgttttttcaaatttttattatgaatcttctaaacccgcgtgaacccacccgtaaacccgca |
200 |
Q |
| |
|
||||||||||||||||| | ||| |||||||||| | |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19876678 |
gttggttgatgaatgatgtagatctgaggtgaggctactgttttttcaaatttctattatgaatcttctcaacccgcgtgaacccacccgtaaacccgca |
19876777 |
T |
 |
| Q |
201 |
accc |
204 |
Q |
| |
|
|||| |
|
|
| T |
19876778 |
accc |
19876781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 101 - 204
Target Start/End: Original strand, 36585559 - 36585662
Alignment:
| Q |
101 |
gttggttgatgaatgatattgatatgaggtgaggatgctgttttttcaaatttttattatgaatcttctaaacccgcgtgaacccacccgtaaacccgca |
200 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| | |||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
36585559 |
gttggttgatgaatgatatagatctgaggtgaggctactgttttttcaaatttctattatgaatcttctcaaccagcgtgaacccacccgtaaacccgca |
36585658 |
T |
 |
| Q |
201 |
accc |
204 |
Q |
| |
|
|||| |
|
|
| T |
36585659 |
accc |
36585662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 101 - 204
Target Start/End: Original strand, 19866876 - 19866979
Alignment:
| Q |
101 |
gttggttgatgaatgatattgatatgaggtgaggatgctgttttttcaaatttttattatgaatcttctaaacccgcgtgaacccacccgtaaacccgca |
200 |
Q |
| |
|
||||||||||||||||| | ||| |||||||||| | |||||||||||||||| ||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
19866876 |
gttggttgatgaatgatgtagatctgaggtgaggctactgttttttcaaatttctattatgaatcttctcaacccgcgtgaatccacccgtaaacccgca |
19866975 |
T |
 |
| Q |
201 |
accc |
204 |
Q |
| |
|
|||| |
|
|
| T |
19866976 |
accc |
19866979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University