View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3425_high_79 (Length: 236)
Name: NF3425_high_79
Description: NF3425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3425_high_79 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 221
Target Start/End: Complemental strand, 31174536 - 31174328
Alignment:
| Q |
13 |
ctcctaattgcaggtgacaaaccaagatggtgggaattcggcagtgcaacaacaatcaataactccgaccacccaaacagtaagaattgtagatgagtgt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31174536 |
ctcctaattgcaggtgacaaaccaagatggtgggaattcggcagtgcaacaaaaatcaataactccgaccacccaaacagtaagaattgtagatgagtgt |
31174437 |
T |
 |
| Q |
113 |
agcaatggagggcttgacttggatatggatgtctttgacctgcttgacacatctggggatggcaatgctcaaggttaccttttggtggattatgaatttg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31174436 |
agcaatggagggcttgacttggatatggatgtctttgacctgcttgacacatctggggatggcaatgctcaaggttaccttttggtggattatgaatttg |
31174337 |
T |
 |
| Q |
213 |
tggactgtg |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
31174336 |
tggactgtg |
31174328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 76 - 221
Target Start/End: Complemental strand, 31205714 - 31205569
Alignment:
| Q |
76 |
tccgaccacccaaacagtaagaattgtagatgagtgtagcaatggagggcttgacttggatatggatgtctttgacctgcttgacacatctggggatggc |
175 |
Q |
| |
|
||||| ||||||||||||||||||||| ||| | ||||| ||||||||||||| |||||||||||||||||| | ||||||||| ||| | || |
|
|
| T |
31205714 |
tccgatcacccaaacagtaagaattgttgataactgtagtcatggagggcttgaattggatatggatgtctttcaaaagcttgacaccagtggttacggg |
31205615 |
T |
 |
| Q |
176 |
aatgctcaaggttaccttttggtggattatgaatttgtggactgtg |
221 |
Q |
| |
|
| ||||||||||||| |||||||||| ||||||||| |||||| |
|
|
| T |
31205614 |
atgtctcaaggttacctcgtggtggattacgaatttgtgaactgtg |
31205569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 31142377 - 31142332
Alignment:
| Q |
176 |
aatgctcaaggttaccttttggtggattatgaatttgtggactgtg |
221 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
31142377 |
aatgctcaaggttaccttatggtggattatgaatttgtggattgtg |
31142332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 91 - 221
Target Start/End: Complemental strand, 31191833 - 31191703
Alignment:
| Q |
91 |
agtaagaattgtagatgagtgtagcaatggagggcttgacttggatatggatgtctttgacctgcttgacacatctggggatggcaatgctcaaggttac |
190 |
Q |
| |
|
|||||||||||| ||| | ||||||| |||||||||||| |||||||| ||||||||| | | ||||||| ||| | || | ||||||||||| |
|
|
| T |
31191833 |
agtaagaattgttgataactgtagcagtggagggcttgaattggatatagatgtctttaaaaggtttgacaccagtggttacgggatgtctcaaggttac |
31191734 |
T |
 |
| Q |
191 |
cttttggtggattatgaatttgtggactgtg |
221 |
Q |
| |
|
|| |||||||||||||||||||||| |||| |
|
|
| T |
31191733 |
ctcgtggtggattatgaatttgtggattgtg |
31191703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University