View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3425_low_57 (Length: 252)

Name: NF3425_low_57
Description: NF3425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3425_low_57
NF3425_low_57
[»] scaffold0459 (1 HSPs)
scaffold0459 (6-252)||(5725-5971)
[»] scaffold0366 (1 HSPs)
scaffold0366 (6-252)||(5725-5971)
[»] chr3 (1 HSPs)
chr3 (77-177)||(49706439-49706539)
[»] chr1 (1 HSPs)
chr1 (101-174)||(2235350-2235423)
[»] chr2 (1 HSPs)
chr2 (77-129)||(12308781-12308833)


Alignment Details
Target: scaffold0459 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: scaffold0459
Description:

Target: scaffold0459; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 6 - 252
Target Start/End: Complemental strand, 5971 - 5725
Alignment:
6 aggagcagagagtgagcaaccttttacaatcactctttgttggagtagcagtgtttgctatgcctgccataaaaatgataccaacttcagttttgtgggg 105  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5971 aggagcaaagagtgagcaaccttttacaatcactctttgttggagtagcagtgtttgctatgcctgccataaaaatgataccaacttcagttttgtgggg 5872  T
106 atactttgcttacatggctattgatagtcttccagggaatcagttttgggaaaggatattgcttctttttgtaagacctagtagatggtacaagtaagtg 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5871 atactttgcttacatggctattgatagtcttccagggaatcagttttgggaaaggatattgcttctttttgtaagacctagtagatggtacaagtaagtg 5772  T
206 aaagttactttgatttcaccattttaacaaaatagacatgaagcatt 252  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
5771 aaagttactttgatttcaccattttaacaaaatagacatgaagcatt 5725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0366 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: scaffold0366
Description:

Target: scaffold0366; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 6 - 252
Target Start/End: Complemental strand, 5971 - 5725
Alignment:
6 aggagcagagagtgagcaaccttttacaatcactctttgttggagtagcagtgtttgctatgcctgccataaaaatgataccaacttcagttttgtgggg 105  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5971 aggagcaaagagtgagcaaccttttacaatcactctttgttggagtagcagtgtttgctatgcctgccataaaaatgataccaacttcagttttgtgggg 5872  T
106 atactttgcttacatggctattgatagtcttccagggaatcagttttgggaaaggatattgcttctttttgtaagacctagtagatggtacaagtaagtg 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5871 atactttgcttacatggctattgatagtcttccagggaatcagttttgggaaaggatattgcttctttttgtaagacctagtagatggtacaagtaagtg 5772  T
206 aaagttactttgatttcaccattttaacaaaatagacatgaagcatt 252  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
5771 aaagttactttgatttcaccattttaacaaaatagacatgaagcatt 5725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 77 - 177
Target Start/End: Complemental strand, 49706539 - 49706439
Alignment:
77 aaaatgataccaacttcagttttgtggggatactttgcttacatggctattgatagtcttccagggaatcagttttgggaaaggatattgcttctttttg 176  Q
    |||| ||||||||| || ||||| |||||||| |||||||||||||| || ||||||||||| ||||||||||| ||||||||||||||||| || ||||    
49706539 aaaaggataccaacctcggttttatggggatattttgcttacatggcaatagatagtcttccggggaatcagttctgggaaaggatattgctcctctttg 49706440  T
177 t 177  Q
    |    
49706439 t 49706439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 101 - 174
Target Start/End: Original strand, 2235350 - 2235423
Alignment:
101 tggggatactttgcttacatggctattgatagtcttccagggaatcagttttgggaaaggatattgcttctttt 174  Q
    |||||||| |||||||| ||||| ||||||||||| |||||||| || ||||||||||||||||||||||||||    
2235350 tggggatattttgcttatatggcaattgatagtctcccagggaaccaattttgggaaaggatattgcttctttt 2235423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 129
Target Start/End: Original strand, 12308781 - 12308833
Alignment:
77 aaaatgataccaacttcagttttgtggggatactttgcttacatggctattga 129  Q
    |||||||| ||||| || || ||||||||||||||||||| |||||| |||||    
12308781 aaaatgattccaacgtctgtattgtggggatactttgctttcatggccattga 12308833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University