View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3425_low_61 (Length: 250)
Name: NF3425_low_61
Description: NF3425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3425_low_61 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 130 - 222
Target Start/End: Complemental strand, 12839154 - 12839062
Alignment:
| Q |
130 |
aaagaaaaattattttgttcgtaggcttaaaacaagagctttagtggttttatccttggaccgacccgattaaagacatgtgtattttttcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
12839154 |
aaagaaaaattattttgttcgtaggcttaaaacgagagctttagtggttttatccttggaccgaccctgctaaagacacgtgtattttttcat |
12839062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 130 - 226
Target Start/End: Complemental strand, 12832350 - 12832254
Alignment:
| Q |
130 |
aaagaaaaattattttgttcgtaggcttaaaacaagagctttagtggttttatccttggaccgacccgattaaagacatgtgtattttttcatttaa |
226 |
Q |
| |
|
||||||||||||||||||||||||| || ||| || | |||||| ||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
12832350 |
aaagaaaaattattttgttcgtaggttttaaatgagggttttagtcgttttatccttggaccgaccctgctaaagacacgtgtattttttcatttaa |
12832254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 6 - 55
Target Start/End: Complemental strand, 12839275 - 12839226
Alignment:
| Q |
6 |
gtccaagaatattcaaaagtaagtgatgcctaaaacaaattttgatacat |
55 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12839275 |
gtccaataatattcaaaagtaagtgatgcctaaaacaaattttgatacat |
12839226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 6 - 52
Target Start/End: Complemental strand, 12832468 - 12832422
Alignment:
| Q |
6 |
gtccaagaatattcaaaagtaagtgatgcctaaaacaaattttgata |
52 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12832468 |
gtccaataatattcaaaagtaagtgatgtctaaaacaaattttgata |
12832422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University