View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3425_low_64 (Length: 249)

Name: NF3425_low_64
Description: NF3425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3425_low_64
NF3425_low_64
[»] chr5 (2 HSPs)
chr5 (2-221)||(38122251-38122471)
chr5 (62-209)||(38113769-38113916)
[»] chr6 (1 HSPs)
chr6 (1-203)||(14914674-14914876)


Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 2 - 221
Target Start/End: Complemental strand, 38122471 - 38122251
Alignment:
2 aagatattattactgttgttattctatattacat-aaaaaatacatgtagttatgaaagtacgtactgtttagcaccatgttgtctcaagataatatcaa 100  Q
    |||||||||||||||||||||||||||||||||| ||||||| ||| |||||||| ||| ||| ||||||| |||  |||||||||||||||||||||||    
38122471 aagatattattactgttgttattctatattacatgaaaaaatgcatttagttatgcaagcacgcactgtttggcagaatgttgtctcaagataatatcaa 38122372  T
101 gaaccctaatggcttcttgataactctcagtttcatgcccctttaaagcattggaaatggcctcgagaggaattttcgaagcaaggctgatttcaacttt 200  Q
    ||||||||||||||||||||||| |||||| ||||||||||||||| ||||||| ||||||||  |||||||||| |  ||||| | |||||||||||||    
38122371 gaaccctaatggcttcttgataattctcagcttcatgcccctttaaggcattggcaatggcctgcagaggaatttccttagcaaagttgatttcaacttt 38122272  T
201 ataagtcttcgaacggtatga 221  Q
    |||||||||||||||||||||    
38122271 ataagtcttcgaacggtatga 38122251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 62 - 209
Target Start/End: Complemental strand, 38113916 - 38113769
Alignment:
62 cgtactgtttagcaccatgttgtctcaagataatatcaagaaccctaatggcttcttgataactctcagtttcatgcccctttaaagcattggaaatggc 161  Q
    |||||||||| ||| ||||||| ||||||||||| |||||||||||||| |||||||||||| |||||||||||||||| ||||| |||||||  |||||    
38113916 cgtactgtttggcagcatgttgcctcaagataatgtcaagaaccctaatcgcttcttgataattctcagtttcatgcccttttaaggcattggcgatggc 38113817  T
162 ctcgagaggaattttcgaagcaaggctgatttcaactttataagtctt 209  Q
    ||  ||||| || || || |||| ||||||||||||||| || |||||    
38113816 ctgcagagggatctttgaggcaaagctgatttcaactttgtaggtctt 38113769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 14914876 - 14914674
Alignment:
1 aaagatattattactgttgttattctatattacataaaaaatacatgtagttatgaaagtacgtactgtttagcaccatgttgtctcaagataatatcaa 100  Q
    ||||||||||||| ||||||| ||| ||||||  | |||| ||||| || | ||||||  ||| ||||||| ||| ||||||||||||||||| ||||||    
14914876 aaagatattattaatgttgttgttcgatattaagttaaaattacatatattaatgaaaacacgcactgtttggcagcatgttgtctcaagatagtatcaa 14914777  T
101 gaaccctaatggcttcttgataactctcagtttcatgcccctttaaagcattggaaatggcctcgagaggaattttcgaagcaaggctgatttcaacttt 200  Q
    ||||||| | ||||||||||||| |||| ||||| || ||||| || ||  ||  ||||||||  ||||||||||| || |||  | |||||||||||||    
14914776 gaacccttagggcttcttgataattctcggtttcttgacccttaaaggctctgtcaatggcctgcagaggaatttttgatgcatagttgatttcaacttt 14914677  T
201 ata 203  Q
    |||    
14914676 ata 14914674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University