View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3425_low_66 (Length: 248)
Name: NF3425_low_66
Description: NF3425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3425_low_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 41560579 - 41560398
Alignment:
| Q |
18 |
agaaaccccattcagaacatgctttggcgagttcatgaacagcctttgtgtggatttcgaggtcatctgaagttaggagagagaaatcaatgactgagat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
41560579 |
agaaaccccattcagaacatgctttggcgatttcatgaacagcctttgtgtggattttgaggtcatctgaggttaggagagagaaatcaatgactgggat |
41560480 |
T |
 |
| Q |
118 |
ggaagctgcaagctcctctgtaacatcaacaatatcatcaggttctgtgagggagtggtaacttgaaggaataggaaaggct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41560479 |
ggaagctgcaagctcctctgtaacatcaacaatatcatcaggttctgcgagggagtggtaacttgaaggaataggaaaggct |
41560398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 41555927 - 41555703
Alignment:
| Q |
18 |
agaaaccccattcagaacatgctttggcgagttcatgaacagcctttgtgtggatttcgaggtcatctgaagttaggagagagaaatcaatgactgagat |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||| ||||||||||||| || |||||||||||||||| || ||| |
|
|
| T |
41555927 |
agaaaccccattcagaacatgccttggctagttcatgaacagcttttgtgtggatttgagggtcatctgaagtgagcagagagaaatcaatgattgggat |
41555828 |
T |
 |
| Q |
118 |
ggaagctgcaagctcctctgtaacatcaacaatatcatcaggttctgtgagggagtggtaacttgaaggaataggaaaggctccgtttgattgtgcaaag |
217 |
Q |
| |
|
||||||||||| ||| |||| |||||||| ||||||| || |||||||||||||||||||| | |||||||| || ||| ||| ||||||| |||||| |
|
|
| T |
41555827 |
ggaagctgcaatctcatctgcaacatcaataatatcaccatgttctgtgagggagtggtaattggaaggaatgagagaggttccatttgattccgcaaag |
41555728 |
T |
 |
| Q |
218 |
gatttgatacttgaaatatttgatg |
242 |
Q |
| |
|
| |||||| |||||||||||||||| |
|
|
| T |
41555727 |
gctttgatgcttgaaatatttgatg |
41555703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University