View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3427_high_11 (Length: 247)

Name: NF3427_high_11
Description: NF3427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3427_high_11
NF3427_high_11
[»] chr2 (1 HSPs)
chr2 (166-247)||(6752627-6752708)


Alignment Details
Target: chr2 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 166 - 247
Target Start/End: Original strand, 6752627 - 6752708
Alignment:
166 atgtggaagaaggaaggtatgaaatattggagcaagatacacatgtaatggctacggaagaaataagcaaaggatccaacat 247  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
6752627 atgtggaagaaggaaggtatgaaatattggaccaagatacacatgtaatggctacggaagaaataagcaaaggatccaacat 6752708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University