View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3427_low_10 (Length: 247)
Name: NF3427_low_10
Description: NF3427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3427_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 9 - 235
Target Start/End: Original strand, 38611061 - 38611287
Alignment:
| Q |
9 |
agcagagattattagagtaattgtgatacatacatcagcgccgtaagaggatttttagcgtagttttcttcagcggtttttcgagtgcggttggctacta |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| | |
|
|
| T |
38611061 |
agcaaagattattagagtaattgtgatacatacatcagcgccgtaagaggatttttagcgtagtcttcttcagcggtttttcgagtgtggttggctacca |
38611160 |
T |
|
| Q |
109 |
gcaaccgacaatagtcctccttatgaaactccatattcaattcttccatgatcgtcaaaagaatcgtcttctaccaccgcaagtatgccgcaagcaaaca |
208 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38611161 |
gcaaccgacgatagtcctccttatgaaactccatattcaattcttccatgatcgtcaaaagaatcgtcttctaccaccgcaagtatgccgcaagcaaaca |
38611260 |
T |
|
| Q |
209 |
catattatatactaagaaggataaaaa |
235 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
38611261 |
catattatatactaagaaggataaaaa |
38611287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University