View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3427_low_12 (Length: 229)
Name: NF3427_low_12
Description: NF3427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3427_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 176
Target Start/End: Original strand, 20582082 - 20582264
Alignment:
| Q |
1 |
attgttcatcaaggtactactaccattcttaacttcttctgccaacaccagatccccacccaccctataatccagcctaatctccaccgctaatcccaat |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
20582082 |
attgttcatcaaggtactaacaccattcttaacttcttctgccaacaccagatccccacccaccctataatccagcctaatctccactgctaatcccaat |
20582181 |
T |
 |
| Q |
101 |
tccctaacc-------atgcattaatttgttgctctgcatagaccggccacgtggcaattggcacaccaaaccacaaactctc |
176 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20582182 |
tccctaaccatctggaatgcattcatttgttgctctgcatagaccggccacgtggcaattggcacaccaaaccacaaactctc |
20582264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 176
Target Start/End: Original strand, 20562919 - 20563101
Alignment:
| Q |
1 |
attgttcatcaaggtactactaccattcttaacttcttctgccaacaccagatccccacccaccctataatccagcctaatctccaccgctaatcccaat |
100 |
Q |
| |
|
|||||||||||||||| | ||||||||| |||||||||||| ||||| ||||||||||||||||||||||| |||||||||||| |||| |||| || |
|
|
| T |
20562919 |
attgttcatcaaggtagttacaccattcttgacttcttctgcctgcaccaaatccccacccaccctataatccaacctaatctccacggctagtcccgat |
20563018 |
T |
 |
| Q |
101 |
tccctaacc-------atgcattaatttgttgctctgcatagaccggccacgtggcaattggcacaccaaaccacaaactctc |
176 |
Q |
| |
|
||||||||| ||||||| ||||||||||| ||||| || |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
20563019 |
tccctaaccatctcgaatgcattcatttgttgctccgcataaactggccacgtggcaattggcacaccataccacaaactctc |
20563101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 4 - 176
Target Start/End: Original strand, 17781740 - 17781919
Alignment:
| Q |
4 |
gttcatcaaggtactactaccattcttaacttcttctgccaacaccagatccccacccaccctataatccagcctaatctccaccgctaatcccaattcc |
103 |
Q |
| |
|
||||||||| |||| | |||||| | ||||||||||||| |||| ||| |||||||| | |||||||| |||||||||||| |||||||||||||| |
|
|
| T |
17781740 |
gttcatcaatgtacgaacaccattttcaacttcttctgcctgtaccaaatctccacccacacgataatccaacctaatctccactgctaatcccaattct |
17781839 |
T |
 |
| Q |
104 |
ctaaccat-------gcattaatttgttgctctgcatagaccggccacgtggcaattggcacaccaaaccacaaactctc |
176 |
Q |
| |
|
|||||||| || || ||||||||||||||||| ||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
17781840 |
ctaaccatttgaaacgcgttcatttgttgctctgcatacaccggccacgtagcaattggcacaccataccacaaactctc |
17781919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University