View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3428_high_11 (Length: 311)

Name: NF3428_high_11
Description: NF3428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3428_high_11
NF3428_high_11
[»] chr1 (2 HSPs)
chr1 (159-248)||(6451263-6451351)
chr1 (25-80)||(6451207-6451262)


Alignment Details
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 159 - 248
Target Start/End: Original strand, 6451263 - 6451351
Alignment:
159 ttcacaattcttgacttctcaacactttatatgcatgtgtgaattaaaaagaaaaatatatagttatgtatgacattggttaatggttga 248  Q
    |||||||||||||||||||||| |||||||||  ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
6451263 ttcacaattcttgacttctcaaaactttatatatatgtgtgaattaaaa-gaaaaatatatagttatgtatgacattggttaatggttga 6451351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 25 - 80
Target Start/End: Original strand, 6451207 - 6451262
Alignment:
25 gttgttatacctaaatccaacatccaaaattttatttagatttatctcatgataaa 80  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
6451207 gttgttatacctaaatccagcatccaaaattttatttagatttatctcatgataaa 6451262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University