View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3428_high_18 (Length: 241)
Name: NF3428_high_18
Description: NF3428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3428_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 2 - 233
Target Start/End: Original strand, 9583297 - 9583547
Alignment:
| Q |
2 |
agttggatgacagttttatgatgaatgatttttattcttcattaattattttgcaattttagaatactgcagagtttcagtcacatcttgtagtcttcca |
101 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
9583297 |
agttggatgacagttttatgatggatgatttttattcttcattaattattttgcaattttagaatactgtagagtttcagtcacatcttatagtcttcca |
9583396 |
T |
|
| Q |
102 |
tcaatgctatcaactagtgacttgcaatccttctcgatggtaaccctcac-------------------aacaatgcagtatctttattgcatttcagct |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9583397 |
tcaatgctatcaactagtgacttgcaatccttctcgatggtaaccctcacatcttgtccttgttgctgaaacaatgcagtatctttattgcatttcagct |
9583496 |
T |
|
| Q |
183 |
ctgttgattgtcccttttatgctctttgcttgcacctctcattcctttgct |
233 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9583497 |
ctgttgattgtcctctttatgctctttgcttgcacctctcattccattgct |
9583547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University