View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3428_high_4 (Length: 426)
Name: NF3428_high_4
Description: NF3428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3428_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 408; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 408; E-Value: 0
Query Start/End: Original strand, 1 - 408
Target Start/End: Original strand, 43091597 - 43092004
Alignment:
| Q |
1 |
taaagggtagtgtgaatgtaaagagttttgctggtgactacacatcaatgggagggaaggtttcacttgtgaggagtccgacaaaatctagatggttttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091597 |
taaagggtagtgtgaatgtaaagagttttgctggtgactacacatcaatgggagggaaggtttcacttgtgaggagtccgacaaaatctagatggttttt |
43091696 |
T |
 |
| Q |
101 |
gtttatgtttggaatgtcgtcgagttccaggatgtcttccaaggagatgcagcttagtgacattagaaatagacagagcagaagtcggagggagccgatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091697 |
gtttatgtttggaatgtcgtcgagttccaggatgtcttccaaggagatgcagcttagtgacattagaaatagacagagcagaagtcggagggagccgatg |
43091796 |
T |
 |
| Q |
201 |
acgatgtttccgacaccggaaaatgggaaagaagttgttaagagtaagagaaatgggaatagtaaagggatgtggaagattttgaagtcaatttcattgg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091797 |
acgatgtttccgacaccggaaaatgggaaagaagttgttaagagtaagagaaatgggaatagtaaagggatgtggaagattttgaagtcaatttcattgg |
43091896 |
T |
 |
| Q |
301 |
ttttaggatgcagtagtagtaaacttgctaatgatgtagtaaaggctgcttttgtgtgaattttggatatcatcttgtgcttaatttcaatgtttattgc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091897 |
ttttaggatgcagtagtagtaaacttgctaatgatgtagtaaaggctgcttttgtgtgaattttggatatcatcttgtgcttaatttcaatgtttattgc |
43091996 |
T |
 |
| Q |
401 |
acattact |
408 |
Q |
| |
|
|||||||| |
|
|
| T |
43091997 |
acattact |
43092004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University