View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3428_low_13 (Length: 266)
Name: NF3428_low_13
Description: NF3428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3428_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 20 - 261
Target Start/End: Complemental strand, 193840 - 193599
Alignment:
| Q |
20 |
gttaggttgcaatctggatcaattggtgcactagaaagtcactatatctttatatatacgcatttggacttgtaggtatatgtacctacctcaccccaat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
193840 |
gttaggttgcaatctggatcaattggtgcactagaaagtcactatatccttatatatacgcatttggacttgtaggtatatgtacctacctcaccccaat |
193741 |
T |
 |
| Q |
120 |
ttgaggtataattaaactgatgaatgttgattgcagtttttagtacaaggtttgccatatttagcagataattgagcatatggggaataccacaaaaata |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
193740 |
ttgaggtataattaaactgatgaatgttgattgcagtttttagtacaaggtttgccatctttagcagataattgagcatacggggaataccacaaaaata |
193641 |
T |
 |
| Q |
220 |
caaataatatagcatatatatagttttcaatattcatctcac |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
193640 |
caaataatatagcatatatatagttttcaatattcatttcac |
193599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University