View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3430_high_18 (Length: 262)
Name: NF3430_high_18
Description: NF3430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3430_high_18 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 262
Target Start/End: Original strand, 43410788 - 43411036
Alignment:
| Q |
16 |
acaccatttgtgcactattgggatgccaatattatataacattggccagtgggacaccgagcgggtaatcatcgtttcatacatttgattgaaaattatt |
115 |
Q |
| |
|
||||| |||||||| |||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410788 |
acaccgtttgtgcattattgggatgtcaatattatataacattggccattgagacaccgagcgggtaatcatcgtttcatacatttgattgaaaattatt |
43410887 |
T |
 |
| Q |
116 |
actctctctctatgtcacataattacggagctttttgttcattttgtacatgttaagaaaaaatgcataagtgaa--agagagaattagttttatgatca |
213 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
43410888 |
actctctctctatgtcacataattaccgagctttttgttcattttgtacattttaagaaaaaatgcataagtgaacgagagaaaattagttttatgatca |
43410987 |
T |
 |
| Q |
214 |
caatccaatgcatggccatggattgtccgttgattctgattgcaatcca |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43410988 |
caatccaatgcatggccatggattgtccgttgattctgattacaatcca |
43411036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 15 - 63
Target Start/End: Original strand, 34955069 - 34955117
Alignment:
| Q |
15 |
gacaccatttgtgcactattgggatgccaatattatataacattggcca |
63 |
Q |
| |
|
||||||| ||||| || |||||||| ||||| ||||||||||||||||| |
|
|
| T |
34955069 |
gacaccacttgtgtaccattgggataccaatgttatataacattggcca |
34955117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 15 - 63
Target Start/End: Original strand, 37811087 - 37811135
Alignment:
| Q |
15 |
gacaccatttgtgcactattgggatgccaatattatataacattggcca |
63 |
Q |
| |
|
||||||| ||||| || |||||||| ||||| ||||||||||||||||| |
|
|
| T |
37811087 |
gacaccacttgtgtaccattgggataccaatgttatataacattggcca |
37811135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University