View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3430_high_22 (Length: 248)
Name: NF3430_high_22
Description: NF3430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3430_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 43568670 - 43568902
Alignment:
| Q |
1 |
accacccatcccgcggttcccgccttctcctccttgataatcctggaaacatccacagcatttctttccttttcaaaaccctaacagacacttacttcga |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43568670 |
accacccattccgcggttcccgccttctcctccttgataatcctggaaacatccacagcatttccttcctattcaaaaccctaacagacacttacttcga |
43568769 |
T |
|
| Q |
101 |
cgtcttcgcaacactcccgccaatcataccgccaggacccattgctgttcttggctttggtgccggctctactgccagtatcatccttaagttttacccc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43568770 |
cgtcttcgcaacactcccgccaatcataccgccaggacccattgctgttcttggctttggtgccggctctactgccagtatcatccttaagttttacccc |
43568869 |
T |
|
| Q |
201 |
aatgcggttgtccatggctgggaacttgatact |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43568870 |
aatgcggttgtccatggctgggaacttgatact |
43568902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University