View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3430_high_32 (Length: 201)
Name: NF3430_high_32
Description: NF3430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3430_high_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 16 - 186
Target Start/End: Original strand, 44942916 - 44943086
Alignment:
| Q |
16 |
atgaaactagacaaaacggaaatcataacttcgtggaagctaaattggacttcgatagtggatgatttcaaaatgtccttgaaagctcgctgatgattta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44942916 |
atgaaactagacaaaacggaaatcataacttcgtggaagctaaattggacttcgatagtggatgatttcaaaatgtccttgaaagctcgctgatgattta |
44943015 |
T |
 |
| Q |
116 |
gaattatattggaaatccatgtgaaggagaagcaaatatattgttcgggaaagtatggccgggacaaaact |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44943016 |
gaattatattggaaatccatgtgaaggagaagcaaatatattgttcgggaaagtatggccgggacaaaact |
44943086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University