View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3430_low_31 (Length: 215)
Name: NF3430_low_31
Description: NF3430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3430_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 3 - 187
Target Start/End: Complemental strand, 4027772 - 4027587
Alignment:
| Q |
3 |
gagcttctcaattaatttattttgtaatgtcttcttattaaattcgaatttgtgttacgaattgatcctgaaactttaaaattattcaatgaaaccgtat |
102 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||| |
|
|
| T |
4027772 |
gagcttctcaaataatttatgctgtaatgtctgcttattaaattcgaatttgtgttacgaattgatcctgaaactttaagatttttcaatgaaacagtat |
4027673 |
T |
 |
| Q |
103 |
gtaatcat-gatttttaccttttcgttctatatttgtagatattgtatgagatgtgatgtaagaccaaaacctttttgtgaccttc |
187 |
Q |
| |
|
|||||||| | ||||||| | || | ||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
4027672 |
gtaatcatggttttttacttcttagctctatatttgtagatattgtatgagctgtgaagtaagaccaaaacctttttgtgaccttc |
4027587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 126 - 193
Target Start/End: Complemental strand, 4013366 - 4013299
Alignment:
| Q |
126 |
gttctatatttgtagatattgtatgagatgtgatgtaagaccaaaacctttttgtgaccttctgcctt |
193 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||||| ||||||| ||||||| |||| |
|
|
| T |
4013366 |
gttctatatttgtagatattgtatgagctgtagagtaagaccaaaacatttttgttaccttcttcctt |
4013299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 126 - 197
Target Start/End: Original strand, 3951222 - 3951293
Alignment:
| Q |
126 |
gttctatatttgtagatattgtatgagatgtgatgtaagaccaaaacctttttgtgaccttctgccttatat |
197 |
Q |
| |
|
|||||||||||||||||||||| ||| | | | ||||||| ||||| ||||||||||||||| || ||||| |
|
|
| T |
3951222 |
gttctatatttgtagatattgttagagctttaaagtaagacaaaaacttttttgtgaccttcttccatatat |
3951293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University