View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3434_high_31 (Length: 247)
Name: NF3434_high_31
Description: NF3434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3434_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 28711565 - 28711416
Alignment:
| Q |
1 |
tgtgcacttttcttccatggaagttatgttcaactttgagatagaatccaaatgcggtttgtcatgtactatgttctcgtatacttccggcaagt--taa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
28711565 |
tgtgcacttttcttccatggaagttatgttcaactttgagatagaatccaaatgcggtatttcatgtactatgttctcgtatacttccggcaagttataa |
28711466 |
T |
 |
| Q |
99 |
acctgcaccaacaccaacaccaaatagactctcttaattcattaaatttcttcccg |
154 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28711465 |
acctg------caccaacaccaaatagactctcttaattcattaaatttcttcccg |
28711416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 226
Target Start/End: Complemental strand, 28711386 - 28711344
Alignment:
| Q |
184 |
gtatgctcaagtgactacttcaaaataactttaaataaggtcg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28711386 |
gtatgctcaagtgactacttcaaaataactttaaataaggtcg |
28711344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University