View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3434_high_41 (Length: 230)
Name: NF3434_high_41
Description: NF3434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3434_high_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 28711887 - 28711734
Alignment:
| Q |
5 |
atcattcttgtttaaaacggtaattaattaatgttcaaactctaaccaacttttgttcagaataatgagtaaaaataaaactgatcttttaatattgata |
104 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28711887 |
atcattcttgtttaaaacagtaattaattaatgttcaaactctaaccaacttttgttcagaataatgagtaaaaataaaactgatcttttaatattgata |
28711788 |
T |
|
| Q |
105 |
gatcaattaacagtcaccgacttgagaagcaaaaatatacatccaccgacgtag |
158 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28711787 |
gatcaattaacattcaccgacttgagaagcaaaaatatacatccaccgacgtag |
28711734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 179 - 227
Target Start/End: Complemental strand, 28711701 - 28711653
Alignment:
| Q |
179 |
gaagaagctaaagtgacgtagatgatattaacatggtgaatgtttcgcc |
227 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28711701 |
gaagaagctaaaatgacgtagatgatattaacatggtgaatgtttcgcc |
28711653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University