View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3434_low_27 (Length: 275)
Name: NF3434_low_27
Description: NF3434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3434_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 133; Significance: 3e-69; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 2681982 - 2682122
Alignment:
| Q |
1 |
ctaacgatttcagcatttttgccgattgagttaggacttgtggattcatgacaattaattcttctccattcatatatgatgatttggtctacaatgtgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2681982 |
ctaacgatttcagcatttttgccgattgagctaggacttatggattcatgacaattaattcttctccattcatatatgatgatttggtctacaatgtgtc |
2682081 |
T |
 |
| Q |
101 |
tctcatcattcggttgtgcaatgatcttgggacagtagtgg |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2682082 |
tctcatcattcggttgtgcaatgatcttgggacagtagtgg |
2682122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 71 - 145
Target Start/End: Original strand, 2687582 - 2687656
Alignment:
| Q |
71 |
catatatgatgatttggtctacaatgtgtctctcatcattcggttgtgcaatgatcttgggacagtagtggtaac |
145 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || | ||||||||| |
|
|
| T |
2687582 |
catatatgatgatttggtctacaatgtttctctcatcattcggttgtgcaatgatcttggaaccgcagtggtaac |
2687656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 214 - 253
Target Start/End: Original strand, 2682196 - 2682235
Alignment:
| Q |
214 |
caccaagaaaagagaatttgtttattaataacgatagaaa |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2682196 |
caccaagaaaagagaatttgtttattaataacgatagaaa |
2682235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 24242671 - 24242716
Alignment:
| Q |
1 |
ctaacgatttcagcatttttgccgattgagttaggacttgtggatt |
46 |
Q |
| |
|
||||| ||||| |||||||||||| |||||||||||||| |||||| |
|
|
| T |
24242671 |
ctaacaatttcggcatttttgccggttgagttaggacttctggatt |
24242716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University