View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3434_low_28 (Length: 268)
Name: NF3434_low_28
Description: NF3434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3434_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 22552201 - 22552254
Alignment:
| Q |
162 |
tccccttccaaccaccgcaacaaacgctgcagtcgcagtcgtaaccccaacgcc |
215 |
Q |
| |
|
|||||||||||||||||||||||||| | |||| |||||||||||||||||| |
|
|
| T |
22552201 |
tccccttccaaccaccgcaacaaacgtcgtcgtcgtagtcgtaaccccaacgcc |
22552254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 13 - 41
Target Start/End: Original strand, 33962309 - 33962337
Alignment:
| Q |
13 |
aacaaatgctgcaatctcccccatttttt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33962309 |
aacaaatgctgcaatctcccccatttttt |
33962337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University