View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3434_low_35 (Length: 243)

Name: NF3434_low_35
Description: NF3434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3434_low_35
NF3434_low_35
[»] chr2 (1 HSPs)
chr2 (11-84)||(15856972-15857045)
[»] chr8 (1 HSPs)
chr8 (67-213)||(20685941-20686081)
[»] chr1 (1 HSPs)
chr1 (116-224)||(13143042-13143151)
[»] scaffold0039 (1 HSPs)
scaffold0039 (138-213)||(66687-66762)
[»] chr7 (2 HSPs)
chr7 (17-230)||(4006428-4006635)
chr7 (17-230)||(4011820-4012027)
[»] scaffold0027 (1 HSPs)
scaffold0027 (116-230)||(53549-53663)
[»] scaffold0669 (1 HSPs)
scaffold0669 (83-116)||(3963-3996)
[»] chr6 (1 HSPs)
chr6 (117-197)||(22858680-22858760)


Alignment Details
Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 11 - 84
Target Start/End: Complemental strand, 15857045 - 15856972
Alignment:
11 attcgcttcaaatttatccttgaagtttttgaatcaaaacatctagcctctctagcatctgatcattgcatatt 84  Q
    ||||| |||||||||||||||||||||||||||||||| |||||| ||||||||| ||||||||||||||||||    
15857045 attcgattcaaatttatccttgaagtttttgaatcaaatcatctaacctctctagtatctgatcattgcatatt 15856972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 67 - 213
Target Start/End: Complemental strand, 20686081 - 20685941
Alignment:
67 atctgatcattgcatattgattcgtatcaatgttctttgtatcgtatcaatatcaatcttcttctgaaaaccatgattcgattcgaatccatgcatatgc 166  Q
    ||||| ||||||| |||||||| |||||||||||| ||  |||      |||||||||||| |||  | |||||||| || ||| ||||||||| ||| |    
20686081 atctggtcattgcttattgatttgtatcaatgttcatttaatc------atatcaatcttcctctagataccatgatccgtttcaaatccatgcttatac 20685988  T
167 agatttgaattgattcaatattcatctaaaaaatgcttgattcgatt 213  Q
    |||||||||| |||| ||| |||||||  ||||||||||||| ||||    
20685987 agatttgaatcgattaaatcttcatctggaaaatgcttgatttgatt 20685941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 116 - 224
Target Start/End: Original strand, 13143042 - 13143151
Alignment:
116 atatcaatcttcttctgaaaaccatgattcgattcgaatccatgcatatgcagatttgaattgattcaatattcatctaaaaaat-gcttgattcgattt 214  Q
    |||||||||||| |||  ||||||||||||||||| ||  | ||| ||||||| ||||||| |||||||| |||||||  ||||| |||||| ||||||     
13143042 atatcaatcttcatctcgaaaccatgattcgattcaaagtcttgcttatgcagttttgaatagattcaatcttcatctggaaaatggcttgaatcgattc 13143141  T
215 agtgttcttg 224  Q
    || |||||||    
13143142 agagttcttg 13143151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0039 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0039
Description:

Target: scaffold0039; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 213
Target Start/End: Complemental strand, 66762 - 66687
Alignment:
138 catgattcgattcgaatccatgcatatgcagatttgaattgattcaatattcatctaaaaaatgcttgattcgatt 213  Q
    ||||||||||||| |||   ||| |||||||||||||||||||||||| ||| |||| ||||||  ||||||||||    
66762 catgattcgattcaaattattgcctatgcagatttgaattgattcaatcttcctctagaaaatgtctgattcgatt 66687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 17 - 230
Target Start/End: Original strand, 4006428 - 4006635
Alignment:
17 ttcaaatttatccttgaagtttttgaatcaaaacatctagcctctctagcatctgatcattgcatattgattcgtatcaatgttctttgtatcgtatcaa 116  Q
    |||||| || || ||| |||||||||||| |  ||| | |||| ||| | ||||||||||||| |||||||| |||| |||| |||||| ||  ||||      
4006428 ttcaaacttttcattggagtttttgaatcgattcatttggcctatctggtatctgatcattgcttattgatttgtattaatgctctttgaattttatc-- 4006525  T
117 tatcaatcttcttctgaaaaccatgattcgattcgaatccatgcatatgcagatttgaattgattcaatattcatctaaaaaatgcttgattcgatttag 216  Q
        ||||||| | || | | ||||||||||||| |||  || | |||||| |||||||| |||||||| ||||| | |||||||||||||| |||| |     
4006526 ----aatcttcatttggacatcatgattcgattcaaatttatacctatgcaaatttgaatggattcaatcttcatatgaaaaatgcttgatttgattcac 4006621  T
217 tgttcttggcattc 230  Q
     ||||||| |||||    
4006622 agttcttgacattc 4006635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 17 - 230
Target Start/End: Original strand, 4011820 - 4012027
Alignment:
17 ttcaaatttatccttgaagtttttgaatcaaaacatctagcctctctagcatctgatcattgcatattgattcgtatcaatgttctttgtatcgtatcaa 116  Q
    |||||| || || ||| |||||||||||| |  ||| | |||| ||| | ||||||||||||| |||||||| |||| |||| |||||| ||  ||||      
4011820 ttcaaacttttcattggagtttttgaatcgattcatttggcctatctggtatctgatcattgcttattgatttgtattaatgctctttgaattttatc-- 4011917  T
117 tatcaatcttcttctgaaaaccatgattcgattcgaatccatgcatatgcagatttgaattgattcaatattcatctaaaaaatgcttgattcgatttag 216  Q
        ||||||| | || | | ||||||||||||| |||  || | |||||| |||||||| |||||||| ||||| | |||||||||||||| |||| |     
4011918 ----aatcttcatttggacatcatgattcgattcaaatttatacctatgcaaatttgaatggattcaatcttcatatgaaaaatgcttgatttgattcac 4012013  T
217 tgttcttggcattc 230  Q
     ||||||| |||||    
4012014 agttcttgacattc 4012027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0027 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0027
Description:

Target: scaffold0027; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 230
Target Start/End: Complemental strand, 53663 - 53549
Alignment:
116 atatcaatcttcttctgaaaaccatgattcgattcgaatccatgcatatgcagatttgaattgattcaatattcatctaaaaaatgcttgattcgattta 215  Q
    ||||| |||||| |||| | ||||||||| ||||| |||   ||| ||| || ||||||||||||| ||| ||||| | ||||||||||||| ||||| |    
53663 atatctatcttcatctggacaccatgatttgattcaaatttctgcctatacaaatttgaattgattgaatcttcatttgaaaaatgcttgatacgattca 53564  T
216 gtgttcttggcattc 230  Q
      ||||||| |||||    
53563 tagttcttgacattc 53549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0669 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0669
Description:

Target: scaffold0669; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 83 - 116
Target Start/End: Complemental strand, 3996 - 3963
Alignment:
83 ttgattcgtatcaatgttctttgtatcgtatcaa 116  Q
    ||||||||||||||||||||||| ||||||||||    
3996 ttgattcgtatcaatgttctttgaatcgtatcaa 3963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 197
Target Start/End: Original strand, 22858680 - 22858760
Alignment:
117 tatcaatcttcttctgaaaaccatgattcgattcgaatccatgcatatgcagatttgaattgattcaatattcatctaaaa 197  Q
    ||||||||||| | || |||||||||||||| || ||||| ||| |||||||  |||||| |||||| | || ||||||||    
22858680 tatcaatcttcatatggaaaccatgattcgactcaaatccctgcctatgcagtattgaatcgattcattcttaatctaaaa 22858760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University