View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3436-Insertion-18 (Length: 143)
Name: NF3436-Insertion-18
Description: NF3436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3436-Insertion-18 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 5e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 5e-54
Query Start/End: Original strand, 7 - 143
Target Start/End: Original strand, 18741715 - 18741848
Alignment:
| Q |
7 |
aaaattaaaatatagagccaaaggactattgtcacattgagaggccccataacaagaccaacaaaatgttatagcgtgtgccatgaaaccataaatcttt |
106 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
18741715 |
aaaattaaaatatagagccaaagga---ttgtcacattgggaggccccataacaagaccaacaaaatgttacagcgtgtgccatgaaaccagaaatcttt |
18741811 |
T |
|
| Q |
107 |
gtatctcctacaagcactagaccccacccttacccta |
143 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18741812 |
gtatctcctacaagcactagaccccacccctacccta |
18741848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University