View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3437_low_3 (Length: 387)
Name: NF3437_low_3
Description: NF3437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3437_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 216 - 373
Target Start/End: Complemental strand, 39753347 - 39753190
Alignment:
| Q |
216 |
tattccttcaattttgttattttcataaggtgttaatcatagtaaaagtttgaccttttaatctgtcttaccaaaatcaaatattcttgtaagaatcata |
315 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39753347 |
tattccttcaattttattattttcataaggtgttaatcatagtaaaagtttgaccttttaatctgtcttaccaaaatcaaatattcttgtaagaatcata |
39753248 |
T |
|
| Q |
316 |
tataaatatgtagtagccctaagaagacaactgaattttcatattgcataagtatgtg |
373 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39753247 |
tataaatatgtagcagccctaagaagacaactgaattttcatattgcataagtatgtg |
39753190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University