View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3439_high_17 (Length: 293)
Name: NF3439_high_17
Description: NF3439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3439_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 163 - 278
Target Start/End: Complemental strand, 52843999 - 52843884
Alignment:
| Q |
163 |
tcaacataatgaacatgtttactaccaaatgtatatgtatccggcgatgatcgctgttctgcatgaccattgttcttgaatttgatcgtgctatgagaaa |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52843999 |
tcaacataatgaacatgtttactaccaaatgtatatgtatccggcgatgatcgctgttctgcatgaccattgttcttgaatttgatcgtgctatgagaaa |
52843900 |
T |
 |
| Q |
263 |
cacattcccattctga |
278 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
52843899 |
cacattcccattctga |
52843884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 13 - 89
Target Start/End: Complemental strand, 52844149 - 52844073
Alignment:
| Q |
13 |
aatattcggtcatgttttacttactatttgtcgaacacaggattacatggatgctgacctttgagaatttgagggtt |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52844149 |
aatattcggtcatgttttacttactatttgtcgaacacaggattacatggatgctgacctttgagaatttgagggtt |
52844073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University