View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3439_high_32 (Length: 236)
Name: NF3439_high_32
Description: NF3439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3439_high_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 6854514 - 6854730
Alignment:
| Q |
1 |
ctatagtgatgttagtctatgtagattacaatcattacatcttagctactggcaattcacttccccacattcagcaacacattaccaaagattaaaagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6854514 |
ctatagtgatgttagtctatgtagattacaatcattacatcttagctactggcaattcacttccccacattcagcaacacattaccaaagattaaaagtt |
6854613 |
T |
 |
| Q |
101 |
agtttacgctcaaacaactttagaatttggcatattttttggctatagaggttcaacacctcaaaaatggtagccatagcgctgctcagcaacaatgtta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6854614 |
agtttacgctcaaacaactttagaatttggcatattttttggctatagaggttcaacacctcaaaaatggtagccatagcgctgctcagcaacaatgtta |
6854713 |
T |
 |
| Q |
201 |
gcattgttgttctatcc |
217 |
Q |
| |
|
||||| ||||||||||| |
|
|
| T |
6854714 |
gcattcttgttctatcc |
6854730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 217
Target Start/End: Complemental strand, 6823712 - 6823678
Alignment:
| Q |
183 |
tgctcagcaacaatgttagcattgttgttctatcc |
217 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6823712 |
tgctctgcaacaatgttagcattgttgttctatcc |
6823678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University