View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3439_high_37 (Length: 228)
Name: NF3439_high_37
Description: NF3439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3439_high_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 45 - 164
Target Start/End: Complemental strand, 43353797 - 43353677
Alignment:
| Q |
45 |
gccacatatggggtgtgccagcagcttagtgtgtctatgtatgtatcagttctcctcaactatcagccaca-tggaaataaactcaataatgaaatcaaa |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43353797 |
gccacatatggggtgtgccagcagcttagtgtgtctatgtatgtatcagttctcctcaactatcagccacagtggaaataaactcaataatgaaatcaaa |
43353698 |
T |
 |
| Q |
144 |
tccaactcatgtttgttttca |
164 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43353697 |
tccaactcatgtttgttttca |
43353677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 45 - 86
Target Start/End: Complemental strand, 1034511 - 1034470
Alignment:
| Q |
45 |
gccacatatggggtgtgccagcagcttagtgtgtctatgtat |
86 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1034511 |
gccacatatgggttgtgccagcagcttagtgtgtctatgtat |
1034470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University