View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3439_low_20 (Length: 290)
Name: NF3439_low_20
Description: NF3439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3439_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 101 - 289
Target Start/End: Original strand, 1363294 - 1363483
Alignment:
| Q |
101 |
agattgggttaatagttatacggtccgatcagtgaccaattgatccaaccactgacctaatgacccagtgttttggccgaatcgactactggttc-tgat |
199 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| | | |
|
|
| T |
1363294 |
agattgggttaatagttatgcggtccgatcaatgaccaattgatccaaccattgacctaatgacccagtgttttggccgaatcgactaccggttcgggtt |
1363393 |
T |
 |
| Q |
200 |
tttaaaacaccagattcactgcaagtattgggtcatttactcatgtaattcattgttgttgggataactaacatatttcaagtcctcctc |
289 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
1363394 |
tttaaaacaccggattcactgcaagtattgggtcatttactcatgtaattcattgttgctgggataactaacatatttcaggtcctcctc |
1363483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University