View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3439_low_26 (Length: 251)
Name: NF3439_low_26
Description: NF3439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3439_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 45 - 242
Target Start/End: Original strand, 48174878 - 48175075
Alignment:
| Q |
45 |
acatttaatcaaaatcaacttttttcacttcgagtcaaacctaagttatctcaatagtaaaacatgtctagttactaaaatcacattcaatagagagaca |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48174878 |
acatttaatcaaaatcaacttttttcacttcgagtcaaacctaagttatcttaatagtaaaacatgtctagtttctaaaatcacattcaatagagagaca |
48174977 |
T |
|
| Q |
145 |
caatcaatttgacattggtcattctctctgcatttaaatggaacttattatactaaacaatgattttgcagacgagtctaaagtttcacctcctatgc |
242 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48174978 |
aaatcaatttgacattggtgattctctctgcatttaaatggaacttattatactaaacaatgattttgcagacgagtctaaagtttcacctcctatgc |
48175075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 48174046 - 48174092
Alignment:
| Q |
1 |
ttctaattctaacctttgttgtaaaagttagtacaagtttttcaaca |
47 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48174046 |
ttctaactctaacctttgttgtaaaagttagtacaagtttttcaaca |
48174092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University