View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3439_low_30 (Length: 247)

Name: NF3439_low_30
Description: NF3439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3439_low_30
NF3439_low_30
[»] chr6 (1 HSPs)
chr6 (20-205)||(13204476-13204661)
[»] chr1 (1 HSPs)
chr1 (20-125)||(3038319-3038424)


Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 20 - 205
Target Start/End: Original strand, 13204476 - 13204661
Alignment:
20 caaggttgttggcaaatctgatggtgaagttagtaaaaaatctaaggaatctgcacaaaaaactgttggtaaatctaaggatcgttctgtgaaaaacggt 119  Q
    |||||||| |||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||    
13204476 caaggttgctggcaaatctgacggtgaaggtagtaaaaaatctaaggaatctgcacaaaaaactggtggtaaatctaaggatcgttctgtgaaaagcggt 13204575  T
120 ggtaaaaattatgtgggtttcgaaatgaggggaattaacggttttattgctgggattgaaacgaaatgaatcaaaatgtgattagg 205  Q
     |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| ||||||||||    
13204576 tgtaaaaattatgtgggtttcgaaatgaggggaattaacggttttgttgctgggattgaaatgaaatgaatcaaattgtgattagg 13204661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 20 - 125
Target Start/End: Original strand, 3038319 - 3038424
Alignment:
20 caaggttgttggcaaatctgatggtgaagttagtaaaaaatctaaggaatctgcacaaaaaactgttggtaaatctaaggatcgttctgtgaaaaacggt 119  Q
    |||||||| ||||||||||||||||||||||| ||||||||| ||||| |||||||||||||||| |||||||||| ||||||||||||||||||  |||    
3038319 caaggttgctggcaaatctgatggtgaagttactaaaaaatccaaggattctgcacaaaaaactggtggtaaatctgaggatcgttctgtgaaaagtggt 3038418  T
120 ggtaaa 125  Q
    ||||||    
3038419 ggtaaa 3038424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University