View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3439_low_30 (Length: 247)
Name: NF3439_low_30
Description: NF3439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3439_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 20 - 205
Target Start/End: Original strand, 13204476 - 13204661
Alignment:
| Q |
20 |
caaggttgttggcaaatctgatggtgaagttagtaaaaaatctaaggaatctgcacaaaaaactgttggtaaatctaaggatcgttctgtgaaaaacggt |
119 |
Q |
| |
|
|||||||| |||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
13204476 |
caaggttgctggcaaatctgacggtgaaggtagtaaaaaatctaaggaatctgcacaaaaaactggtggtaaatctaaggatcgttctgtgaaaagcggt |
13204575 |
T |
 |
| Q |
120 |
ggtaaaaattatgtgggtttcgaaatgaggggaattaacggttttattgctgggattgaaacgaaatgaatcaaaatgtgattagg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
13204576 |
tgtaaaaattatgtgggtttcgaaatgaggggaattaacggttttgttgctgggattgaaatgaaatgaatcaaattgtgattagg |
13204661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 20 - 125
Target Start/End: Original strand, 3038319 - 3038424
Alignment:
| Q |
20 |
caaggttgttggcaaatctgatggtgaagttagtaaaaaatctaaggaatctgcacaaaaaactgttggtaaatctaaggatcgttctgtgaaaaacggt |
119 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||| ||||| |||||||||||||||| |||||||||| |||||||||||||||||| ||| |
|
|
| T |
3038319 |
caaggttgctggcaaatctgatggtgaagttactaaaaaatccaaggattctgcacaaaaaactggtggtaaatctgaggatcgttctgtgaaaagtggt |
3038418 |
T |
 |
| Q |
120 |
ggtaaa |
125 |
Q |
| |
|
|||||| |
|
|
| T |
3038419 |
ggtaaa |
3038424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University