View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3439_low_35 (Length: 235)
Name: NF3439_low_35
Description: NF3439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3439_low_35 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 4600107 - 4600327
Alignment:
| Q |
1 |
atcctttagtgaaaaagaaaaagtccaagtcttgtaacatcatttgtaacaccattcatttttaaggtgtcacagtattta-agaaaaatagttaagtga |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
4600107 |
atcctttagtgaaaaagaaaaagtccaagtcttgtaacatcatttgtaacaccattcatttttaaggtgtcactgtattttgagaaaaatagttaagtga |
4600206 |
T |
|
| Q |
100 |
agattgcgatcattcgtaaggaaaccaaaaaattggttttggttcaaaattgttcgcctccactgttggtcgtgcaatgctttaatgtggttttgtagcg |
199 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4600207 |
agattgcgatcattcttaaggaaaccaaaaaattggttttggttcaaaattgttcgcctccactgttggtcgtgcaatgctttaatgtggttttgtagcg |
4600306 |
T |
|
| Q |
200 |
gtgggagtgacacaatctttt |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4600307 |
gtgggagtgacacaatctttt |
4600327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University