View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3439_low_39 (Length: 215)
Name: NF3439_low_39
Description: NF3439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3439_low_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 66 - 198
Target Start/End: Complemental strand, 45101509 - 45101377
Alignment:
| Q |
66 |
aataataatgcaaggcaacaatcatactttacacacgttagtttcgacaagtaacaacaatcggatcattatctttgttaaccacattcatggctaatag |
165 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45101509 |
aataataatgcaagacaacaatcatattttacacacgttagtttcgaaaagtaacaacaatcggatcattatctttgttaaccacattcatgactaatag |
45101410 |
T |
|
| Q |
166 |
gattttaggttccgtacttttgtctataaatat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45101409 |
gattttaggttccgtacttttgtctataaatat |
45101377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 13 - 66
Target Start/End: Complemental strand, 45101583 - 45101530
Alignment:
| Q |
13 |
agaatatgtgtgtggatgtagtgccaaaaaagagttatataacatggaggagta |
66 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45101583 |
agaatatttgtatggatgtagtgccaaaaaagagttatataacatggaggagta |
45101530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University