View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3440_high_11 (Length: 253)

Name: NF3440_high_11
Description: NF3440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3440_high_11
NF3440_high_11
[»] chr8 (1 HSPs)
chr8 (1-238)||(3629263-3629499)


Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 3629499 - 3629263
Alignment:
1 tattgcagacctttgggaatttttgttgttaattaaggttcttatttattggtagnnnnnnnnnnnnngaaagtatttattggtacacttgtttagttcc 100  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||             ||||||||||||||||||||||||||||||||    
3629499 tattgcagacctttgggaattttt-ttgttaattaaggttcttatttattggtagtttttttatttttgaaagtatttattggtacacttgtttagttcc 3629401  T
101 tatgaacccaacaaaaatggataatggaaccaagatctagaagcaaccgtaaattgggtcccaatgaataaccggtactcgttgttagatccttataaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3629400 tatgaacccaacaaaaatggataatggaaccaagatctagaagcaaccgtaaattgggtcccaatgaataaccggtactcgttgttagatccttataaat 3629301  T
201 caagaaatgaagattaggtcttctcaagtgatgaaact 238  Q
    ||||||||||||||||||||||||||||||||||||||    
3629300 caagaaatgaagattaggtcttctcaagtgatgaaact 3629263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University