View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3440_high_20 (Length: 237)
Name: NF3440_high_20
Description: NF3440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3440_high_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 4411059 - 4410920
Alignment:
| Q |
1 |
aagaatggatttaaatagggtaggcgataacatgtatctcaagtttagtttctctaaataggatgaaccaaatctgaagcaatctcaggagcagatatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4411059 |
aagaatggatttaaatagggtaggcgataacgtgtatctcaagtttagtttctctaaataggatgaaccaaatctgaagcaatctcaggagcagatatat |
4410960 |
T |
|
| Q |
101 |
gaactaatgggagagcaccttcacaatactataaataaac |
140 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4410959 |
gaactaataggagagcaccttcacaatactataaataaac |
4410920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University