View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3440_low_17 (Length: 245)
Name: NF3440_low_17
Description: NF3440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3440_low_17 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 96 - 245
Target Start/End: Original strand, 12948280 - 12948418
Alignment:
| Q |
96 |
aactttgctttatagttcacaaaagtaaacttcccatcatgcttcatgcttcatgctcaatgcttatttatttcttttgctgatccatcaacctcatctt |
195 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12948280 |
aactttgctttgtagttcacaaaagtaaacttcccatcatgcttcatgct-------caatgcttat----ttcttttgctgatccatcaacctcatctt |
12948368 |
T |
 |
| Q |
196 |
acacatttgtttattactaaaatatttcaactttctcaaaccaagatatc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12948369 |
acacatttgtttattactaaaatatttcaactttctcaaaccaagatatc |
12948418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 31 - 127
Target Start/End: Original strand, 12958016 - 12958112
Alignment:
| Q |
31 |
aaaaatcatgttaaagccttaaccttaaaagataattgaagctgacaaatatatgctacaaaagtaactttgctttatagttcacaaaagtaaactt |
127 |
Q |
| |
|
||||| |||||||||||||| ||||||||| |||||||| ||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
12958016 |
aaaaaccatgttaaagccttcaccttaaaaaataattgattttgacaaatatatgctacaaaagtgactttgctttatcgttcacaaaagtaaactt |
12958112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University