View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3442_high_6 (Length: 237)

Name: NF3442_high_6
Description: NF3442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3442_high_6
NF3442_high_6
[»] chr4 (1 HSPs)
chr4 (1-220)||(46865160-46865381)


Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 46865160 - 46865381
Alignment:
1 cgtggttacacaagtaggtactaaaattgcttttcagatatnnnnnnnngttggatagtactctactttggtatgtgtcgatggatactctacttttcat 100  Q
    ||||||||||||||||||||| |||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||    
46865160 cgtggttacacaagtaggtaccaaaattgcttttcagatataaaaaaaagttggatagtactctactttggtatgtgtcgatggatactctacttttcat 46865259  T
101 atatggttaacgcagctgcagtgttagagactaaaaaaccttaacgtctctgcaacattcgtggtcactgtcctt--tatatatatattgggtgtgatta 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||  |||||||||||||||||||||||    
46865260 atatggttaacgcagctgcagtgttagagactaaaaaaccttaacgtctctgcaacatttgtggtcactgtcctttatatatatatattgggtgtgatta 46865359  T
199 cttgtattcacatattgtgaac 220  Q
    |||||||| |||||||||||||    
46865360 cttgtatttacatattgtgaac 46865381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University