View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3442_high_9 (Length: 207)
Name: NF3442_high_9
Description: NF3442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3442_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 2e-35; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 42 - 117
Target Start/End: Original strand, 45672777 - 45672852
Alignment:
| Q |
42 |
taagaagaagaatcatgatagagttgggaaaggcgaagaagttgatgaatggagttcatgagagaagggtaattag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45672777 |
taagaagaagaatcatgatagagttgggaaaggcgaagaagttgatgaatggagttcatgagagaagggtaattag |
45672852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University