View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3442_high_9 (Length: 207)

Name: NF3442_high_9
Description: NF3442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3442_high_9
NF3442_high_9
[»] chr2 (1 HSPs)
chr2 (42-117)||(45672777-45672852)


Alignment Details
Target: chr2 (Bit Score: 76; Significance: 2e-35; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 42 - 117
Target Start/End: Original strand, 45672777 - 45672852
Alignment:
42 taagaagaagaatcatgatagagttgggaaaggcgaagaagttgatgaatggagttcatgagagaagggtaattag 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45672777 taagaagaagaatcatgatagagttgggaaaggcgaagaagttgatgaatggagttcatgagagaagggtaattag 45672852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University