View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3442_low_7 (Length: 237)
Name: NF3442_low_7
Description: NF3442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3442_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 46865160 - 46865381
Alignment:
| Q |
1 |
cgtggttacacaagtaggtactaaaattgcttttcagatatnnnnnnnngttggatagtactctactttggtatgtgtcgatggatactctacttttcat |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46865160 |
cgtggttacacaagtaggtaccaaaattgcttttcagatataaaaaaaagttggatagtactctactttggtatgtgtcgatggatactctacttttcat |
46865259 |
T |
|
| Q |
101 |
atatggttaacgcagctgcagtgttagagactaaaaaaccttaacgtctctgcaacattcgtggtcactgtcctt--tatatatatattgggtgtgatta |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46865260 |
atatggttaacgcagctgcagtgttagagactaaaaaaccttaacgtctctgcaacatttgtggtcactgtcctttatatatatatattgggtgtgatta |
46865359 |
T |
|
| Q |
199 |
cttgtattcacatattgtgaac |
220 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
46865360 |
cttgtatttacatattgtgaac |
46865381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University