View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3444_high_6 (Length: 278)
Name: NF3444_high_6
Description: NF3444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3444_high_6 |
 | |
|
| [»] scaffold0078 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 52; Significance: 7e-21; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 5 - 71
Target Start/End: Complemental strand, 2551617 - 2551548
Alignment:
| Q |
5 |
aagtcttcacttggactagtgataagaa---tttttaggtcctttatataacagtaagtatggcagtttt |
71 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2551617 |
aagtcttcacttggactagtgataagaagaatttttaggtcctttatataacagtaagtatgccagtttt |
2551548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 198 - 278
Target Start/End: Complemental strand, 2558951 - 2558870
Alignment:
| Q |
198 |
ttatccctcatcatatatttccatgtctg-aaaacgacacgaaatccattttacttgttgacttccgttgctgagcaaaata |
278 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| ||||| |||||||| ||| |||||||| || ||||||||||| |
|
|
| T |
2558951 |
ttatccctcatcatatgtttccatgtctggaaaacgacatgaaattcattttacctgtcgacttccgatgttgagcaaaata |
2558870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 2559256 - 2559163
Alignment:
| Q |
1 |
ttgcaagtcttcacttggactagtgataagaa---tttttaggtcctttatataacagtaagtatggcagttttatcaaaaataaaatatcaaa |
91 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||| ||||| |||||| ||||| |||||||||| | |||||||||||||||||| |||||| |
|
|
| T |
2559256 |
ttgcaagtcttcacttggactagtaatacgaaggatttttcagtccttcgtataatagtaagtatgccggttttatcaaaaataaaacatcaaa |
2559163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 48 - 91
Target Start/End: Original strand, 15948 - 15994
Alignment:
| Q |
48 |
tataacagtaagtat---ggcagttttatcaaaaataaaatatcaaa |
91 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
15948 |
tataacagtaagtattatgccagttttatcaaaaataaaatatcaaa |
15994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University