View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3444_low_8 (Length: 251)
Name: NF3444_low_8
Description: NF3444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3444_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 50 - 235
Target Start/End: Original strand, 42936456 - 42936641
Alignment:
| Q |
50 |
catgctcctacagagttgtttgattcataaatggaagcagaaacaccaaaatctgcaagtttcactaatccatttgagtcaacaaggatgttaccggatt |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42936456 |
catgctcctacagagttgtttgattcataaatggaagcagaaacaccaaaatctgcaagtttcactaatccatttgagtcaacaaggatgttaccagatt |
42936555 |
T |
|
| Q |
150 |
tgatatctctatgaagatgtccttgtccatgaaggtaagaaagagcattgagagtgtctttgagaataacagctatggattgttct |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42936556 |
tgatatctctatgaagatgtccttgtccatgaaggtaagaaagagcattgagagtgtctttgagaataacagctatggattgttct |
42936641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University